MaizeGDB
jobs | upcoming events | sitemap
 | docs | bulk data | browse data | tools | login / register | links 
homeA popup window providing help for using the search form to the right  

Project Documentation & Protocols: Maize Gene Discovery Project: ESTs: Libraries

Contents: Index | Libraries | Reports | Assembly | Annotation | Unigene | Search | Ordering | Protocols | FAQs

In these tables, the EST libraries for the Maize Gene Discovery Project are described in numerical order. Other EST libraries information can be obtained through ZmDB database.

Library

486 - Immature leaf

Made by

Joseph Colasanti

Cultivar

B73

Organ

Shoot

Tissue

Leaf

Development stage

P5/6 - P10/11

Host cell

E. coli XL1-Blue MFR'

Vector

PBluescriptSK(-)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

TGTAAAACGACGG CCAGT (m13-21)

3' Sequencing primer

GGAAACAGCTA TGACCATG

Cloning sites

XhoI/EcoRI

Description

The library was made from leaves P5/6 to P10/11. In terms of size, the leaves extend from 4 cm to 8 cm above the apex. This means that the bases of the leaves, nearest the apex, are not included. Also the outer leaves are not included.

 

Library

487 - Apical meristem

Made by

Hake lab

Cultivar

B73

Organ

Shoot

Tissue

Apical meristem

Development stage

Immature

Host cell

E.coli XL1-Blue

Vector

PBluescriptSK(-)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

 

Description

This library was made from tissues enriched in shoot apical meristem, no young leaf primordia were included.

 

Library

496 - Stressed shoot

Made by

Hong Wang (Bohnert lab)

Cultivar

B73

Organ

Shoot

Tissue

Seedling

Development stage

Salt stress

Host cell

E. coli XL Gold

Vector

PBluescriptII SK(+)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

The library is made from salt stressed shoot of B73 inbred. 8 seeds/pot were planted in a 4-inch pot. After germination, seedlings were kept at 23-28 ° C with 12 hours light. The seedlings were initially watered with tap water for the first two days, then with 0.25X Hoaglands solution, supplemented with 1 mM K+ and 2mM Ca++, for approximately 10 days until 3-4 leaves had appeared. The plants were subjected to salt stress by treatment with 150mM NaCl in 0.25X Hoaglands solution containing 1mM K+ and 2mM Ca++ for 24 hours.

 

Library

603 - Stressed root

Made by

Hong Wang (Bohnert lab)

Cultivar

B73

Organ

Root

Tissue

Seedling

Development stage

Salt stress

Host cell

E. coli XL Gold

Vector

PbluescriptII SK(+)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

The library is made from salt stressed root of B73 inbred. 8 seeds/pot were planted in a 4-inch pot. After germination, seedlings were kept at 23-28 ° C with 12 hours exposure to light per day. The seedlings were initially watered with tap water for the first two days, then with 0.25X Hoaglands solution, supplemented with 1 mM K+ and 2mM Ca++, for approximately 10 days until 3-4 leaves had appeared. The plants were subjected to salt stress by treatment with 150mM NaCl in 0.25X Hoaglands solution containing 1mM K+ and 2mM Ca++ for 24 hours.

 

Library

605 - Endosperm

Made by

Schmidt lab

Cultivar

Ohio43

Organ

Kernel

Tissue

Nucellus, embryo and endosperm

Development stage

10-14 days post pollination

Host cell

XLOLR

Vector

pAD-GAL4

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid3.htm and

http://www.stratagene.com/vectors/selection/lambda.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

CTATTCGATGATGAAGATACC (custom)

Cloning sites

XhoI/EcoRI

Description

The library was constructed from poly (A+) RNA extracted from 10 to 14 days post pollinated endosperm, which also included 10-11 DAP embryo and nucellar tissue. The cDNAs were directionally cloned into the EcoRI/XhoI sites of Stratagene's HybriZAP and were excised as inserts in phagemid pAD-GAL4.

 

Library

606 - Ear tissue

Made by

Schmidt lab

Cultivar

Ohio43

Organ

Immature ear

Tissue

Mixed

Development stage

Ear length from 0.5cm-2.0cm

Host cell

XLOLR

Vector

pBK-CMV

Vector type

Phagemid

Selection marker

Neo-Kan

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/dualmode.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

The library was constructed from poly (A+) RNA using a cDNA synthesis kit from Stratagene. The cDNAs were directionally cloned into the EcoRI/XhoI sites of Stratagene's lambda ZAP Express and excised as inserts in plasmid pBK-CMV.

 

Library

614 - Root

Made by

Lukas Mueller (Walbot lab)

Cultivar

W23

Organ

Root

Tissue

Root

Development stage

3-4 days old

Host cell

XLOLR

Vector

PBluescriptII SK(+)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page

http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

The library was made from inbred W23 maize roots grown in the dark for 3 to 4 days. The roots were 0.5 to 2.0 cm long. The cDNAs were directionally cloned into pBluescript SK(+).

 

Library

618 - Tassel primordia

Made by

Schmidt lab

Cultivar

Ohio43

Organ

Tassel

Tissue

Tassel

Development stage

Tassel length from 0.1 to 2.5 cm

Host cell

XLOLR

Vector

pAD-GAL4

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid3.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

CTATTCGATGATGAAGATACC (custom)

Cloning sites

XhoI/EcoRI

Description

 

 

Library

660 - Mixed stages of anther and pollen

Made by

Walden laboratory; plasmids prepped by Amie Franklin

Cultivar

Ohio43

Organ

Anther, pollen

Tissue

Whole premieotic anthers to pollen shed

Development stage

Premieotic anthers to pollen shed

Host cell

XLOLR

Vector

PBluescriptSK(-)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

http://www.stratagene.com/vectors/selection/lambda.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

The library was constructed using Lambda ZAP commercially available from Stratagene.

 

Library

683 - 14 day immature embryo

Made by

Hake lab

Cultivar

B73

Organ

Embryo

Tissue

Embryo

Development stage

14 days after pollination

Host cell

DH10B

Vector

pBK-CMV

Vector type

Phagemid

Selection marker

Neo-Kan

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/dualmode.htm http://www.stratagene.com/vectors/selection/lambda.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

Library was constructed by directional cloning of the inserts in vector pBK-CMV using the ZAP Express cDNA synthesis kit from Stratagene.

 

Library

687 - mixed stages of embryo development

Made by

Torbert Rocheford lab

Cultivar

Illinois High Oil

Organ

Ear

Tissue

Embryo

Development stage

14, 21, 28, and 35 days after pollination

Host cell

E.coli SOLR

Vector

PBluescript SK(-)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

687 was developed from a pool of equal amounts of RNA from developing embryos sampled at 14, 21, 28 and 35 days after pollination of the Illinois High Oil Maize Strain Cycle 90. This closed strain has been selected for high oil concentration for 90 generations and originates from the 1890s era open pollinated variety Burr's White. The library was prepared by Stratagene using the Uni-ZAP XR system (Stratagene BN937328-12). Clones were picked by a Q-bot after blue/white selection.

 

Library

707 - Mixed adult tissues

Made by

Soo-Hwan Kim (Walbot lab)

Cultivar

W23

Organ

Tassel, kernel, silk, husk, root, leaf

Tissue

Tassel, kernel, silk, husk, root, leaf

Development stage

Adult

Host cell

DH10B

Vector

PGAD10

Vector type

Plasmid

Selection marker

Ampr

Vector information

See Clontech web page

http://www.clontech.com/techinfo/vectors/pGAD10.html

5' Sequencing primer

GTGAACTTGCGGGGTTTTTCA (forward custom)

3' Sequencing primer

CTATTCGATGATGAAGATACC (reverse custom)

Cloning sites

EcoRI

Description

The cDNA library was prepared from fully differentiated maize tissues harvested from an active Mutator plant. The tissue ratio by weight was 4:2:1:1:1:1 (tassel:kernel:silk:husk:root:leaf). CDNAs were directionally cloned.

 

Library

829 - Silk infected with Fusarium

Made by

Sharon Allard

Cultivar

B73

Organ

Silk

Tissue

Silk

Development stage

Adult

Host cell

DH10B

Vector

pBluescript II SK(+)

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

cDNA library of silk infected with 1 microliter of 500,000 spores/ml solution of Fusarium graminearum DACM 180378. The library was prepared by Sharon Allard of Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada using Stratagene cDNA synthesis kit. Silk was harvested at 72 hours post-infection.

 

Library

945 - Mixed adult tissues
Note: 945 and 707 are exactly the same thing - just two different times of sequencing

Made by

Soo-Hwan Kim (Walbot lab)

Cultivar

W23

Organ

Tassel, kernel, silk, husk, root, leaf

Tissue

Tassel, kernel, silk, husk, root, leaf

Development stage

Adult

Host cell

DH10B

Vector

PGAD10

Vector type

Plasmid

Selection marker

Ampr

Vector information

See Clontech web page

http://www.clontech.com/techinfo/vectors/pGAD10.html

5' Sequencing primer

(not yet determined)

3' Sequencing primer

TACCACTACAATGGATG (reverse custom)

Cloning sites

EcoRI

Description

The cDNA library was prepared from fully differentiated maize tissues harvested from an active Mutator plant. The tissue ratio by weight was 4:2:1:1:1:1 (tassel:kernel:silk:husk:root:leaf). CDNAs were directionally cloned.New library number given to library 707 for additional sequencing.

 

Library

946 - tassel primordium prepared by Schmidt lab

Made by

George Chuck, Sharon Stanfield

Cultivar

OH43

Organ

Tassels

Tissue

Tassels

Development stage

just after the transition from vegetative to inflorescence

Host cell

XLOLR

Vector

PAD-GAL4-2.1

Vector type

Phagemid

Selection marker

Ampr

Vector information

See CloneTech's web page http://www.clontech.com/techinfo/vectors_dis/pGAD10.html

5' Sequencing primer

CTATTCGATGATGAAGATACC (custom)

3' Sequencing primer

TAATACGACTCACTATAGGGC (T7 promotor sequence)

Cloning sites

XhoI/EcoRI

Description

George Chuck dissected immature tassels between 1mm and 3mm. Sharon Stanfield prepared the cDNA library in HybriZAP. Sample insert size range was 350 bp to 3 Kb with a 1 Kb average.

 

Library

947 - 2 week shoot from Barkan lab

Made by

Alice Barkan

Cultivar

B73

Organ

Shoot

Tissue

leaf and stem, including leaf base

Development stage

2 week old seedling (3 leaves)

Host cell

XL1-Blue

Vector

pBlueScript SK-

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page http://www.stratagene.com/vectors/selection/plasmid1.htm

5' Sequencing primer

AATACGACTCACTATAG (T7)

3' Sequencing primer

ATTAACCCTCACTAAAG (T3)

Cloning sites

XhoI/EcoRI

Description

Directionally cloned using Stratagene's UniZap XR cDNA cloning kit with the 5' end at the EcoRI site. The library represents 8X10e5 independent recombinant phage. The library was greenhouse grown.

 

Library

949 - Juvenile leaf and shoot cDNA from Steve Moose

Made by

Steve Moose, Schmidt's lab

Cultivar

W64A

Organ

Juvenile vegetative shoots

Tissue

Immature leaf primordium and vegetative meristem

Development stage

4 stages from 3-13 days after imbibing

Host cell

E. coli XLOLR

Vector

pAD-GAL4-2.1

Vector type

Plasmid

Selection marker

Ampr

5' Sequencing primer

CTATTCGATGATGAAGATACC (custom)

3' Sequencing primer

TAATACGACTCACTATAGGGC (T7 promotor sequence)

Cloning sites

EcoRI/XhoI

Description

Equal amounts of total RNA by weight from 4 tissue sources (see below) were pooled, polyA+ RNA isolated, and cDNA synthesized for EcoRI (5') and XhoI (3') directional cloning into lambda Hybrizap vector from Stratagene.

Tissue Sources.
1. Whole shoots 3 days after sowing/imbibing in wet soil.
2. Basal 1.5 cm shoots 6 days after sowing - includes yellow portions of developing leaves 1-5, primordia from 6-8, and the vegetative apex.
3. Non-green portions of developing leaves 4-5 and the vegetative apex, including adult leaf primordia, 9 days after sowing.
4. Partially expanded and greening leaves 4-5 at 13 days after sowing.

 

Library

950 and 3524 - Mature pollen from Sheila McCormick's lab.
Note: This library was sequenced at two different times, hence the two project tracking numbers

Made by

Rima Kulikauskas

Cultivar

B73

Organ

N/A

Tissue

Pollen

Development stage

Mature

Host cell

SOLR

Vector

Stratagene's Uni-Zap XR (pBluescript SK-)

Vector type

Phagemid

Selection marker

Ampr

Cloning sites

EcoRI/XhoI

Description

Unamplified cDNA library directionally cloned by Rima Kulikauskas using Stratagene's Uni-Zap system. Insert sizes ranged from 0.5Kb to 2Kb. 50 microliter aliquot had 338,000 pfu when it was made in Sept, 1995, from oligo dT-primed poly A+ RNA.

 

Library

951 - BMS tissue from Walbot Lab (GR)

Made by

George Rudenko

Cultivar

BMS (Black Mexican Sweet)

Organ

N/A

Tissue

Suspension culture

Development stage

Mixed logarithmic and stationary growth phases

Host cell

DH10B

Vector

pUC19

Vector type

Plasmid

Selection marker

Ampr

Cloning sites

EcoRI/EcoRI

Description

The library was prepared by George Rudenko using poly (A) selected RNA and Universal Riboclone cDNA Synthesis System (Promega). cDNA was synthesized using both random and oligo(dT) primers in separate reactions and equipped with EcoRI adaptors. Library was size-fractionated on agarose gels (for insert size >400bp) and non-directionally cloned into EcoRI-digested pUC19 vector. Blue/white selection on carbenicillin-containing plates was used to recover positive clones.

Everything about 951 and 952 is the same except they were prepared at different times. The reason is that 951 had a lot of ribosomal RNA so the library was redone with an additional screening/selection step for mRNA.

 

Library

952 - BMS tissue from Walbot Lab (GR)

Made by

George Rudenko

Cultivar

BMS (Black Mexican Sweet)

Organ

N/A

Tissue

Suspension culture

Development stage

Mixed logarithmic and stationary growth phases

Host cell

DH10B

Vector

pUC19

Vector type

Plasmid

Selection marker

Ampr

Cloning sites

EcoRI/EcoRI

Description

The library was prepared by George Rudenko using poly (A) selected RNA and Universal Riboclone cDNA Synthesis System (Promega). cDNA was synthesized using both random and oligo(dT) primers in separate reactions and equipped with EcoRI adaptors. Library was size-fractionated on agarose gels (for insert size >400bp) and non-directionally cloned into EcoRI-digested pUC19 vector. Blue/white selection on carbenicillin-containing plates was used to recover positive clones.

 

Library

953 - Immature ear with common ESTs screened by Schmidt lab

Made by

Schmidt lab

Cultivar

OH43

Organ

Immature ear

Tissue

Inflorescence meristem - floral organ primordia

Development stage

0.5 cm to 2 cm

Host cell

Stratagene XLOLR

Vector

ZAP Express (pBK-CMV)

Vector type

Phagemid

Selection marker

Neo-Kan

Cloning sites

EcoRI\/XhoI

Description

RNA from library 606 was filtered for common ESTs found in 606.

 

Library

1091 - Immature ear tissue with common inserts from library 606 screened by Schmidt lab
Note: 1091 is library 606 subtracted for common clones to enrich for rare clones

Made by

Sharon Stanfield

Cultivar

B73

Organ

Immature ear

Tissue

Mixed

Development stage

Before pollen shed

Host cell

Stratagene XLOLR

Vector

pAD-GAL4

Vector type

Phagemid

Selection marker

Ampr

Vector information

See Stratagene's web page
http://www.stratagene.com/vectors/selection/pasmid1.htm

5' Sequencing primer

CTATTCGATGATGAAGATACC (custom)

3' Sequencing primer

TAATACGACTCACTATAGGGC (T7 promotor sequence)

Cloning sites

EcoRI/XhoI

Description

Ear cDNA library derived from developing ears (0.5 to 2.0 cm) of inbred OH43. Directionally cloned into the EcoRI/XhoI sites in ZapExpress. Sequenced from plasmids (pBK-CMV). Created by Schmidt lab.

 

Library

3524 - Mature pollen from Sheila McCormick's lab

Made by

Rima Kulikauskas

Cultivar

B73

Tissue

Pollen

Development stage

Mature

Host cell

SOLR

Vector

Stratagene's Uni-Zap XR (pBluescript SK-)

Selection marker

Ampr

Cloning sites

EcoRI/XhoI

Description

Unamplified cDNA library directionally cloned by Rima Kulikauskas using Stratagene's Uni-Zap system. Insert sizes ranged from 0.5Kb to 2Kb. 50 Microliter aliquot had 338,000 pfu when it was made in Sept, 1995, from oligo dT-primed poly A+ RNA.

 

Library

3528 - Positive selection of MADS-box genes from ear library 946

Cultivar

OH43

Tissue

ear

Development stage

0.5 cm - 2.0 cm

Host cell

XLOLR

Vector

pAD-GAL4

Selection marker

Ampr

Cloning sites

EcoRI/XhoI

Description

Schmidt lab dissected immature ears between 0.5 cm - 2.0 cm. Sharon Stanfield prepared the cDNA library in HybriZAP. Positive selection by probing with the pooled full-length cDNA of the following MADS box genes: ZAGL8B, ZAGL9B, ZAGL17, SI, ZAG1, ZAG2, ZAP1A, ZMM2, and ZPIA. Negative selection by probing with pooled 3'-end fragments of the same DNA. The final library is derived from a total of 210 selected plaques that hybridized with the full-length cDNA probes, but not with the 3'-end cDNA probes.


Return to Documentation Index | Return to Maize Gene Discovery Project Index | Return to Homepage

home  

Be sure to cite us!

This page is HTML 4.01 valid!